UCE Enrichment¶
| Author: | Brant Faircloth, Travis Glenn, John McCormack, Mike Harvey, Laurie Sorenson, Michael Alfaro, Noor White, SI 2012 Seqcap Training Workshop participants, MYcroarray / Arbor Biosciences, Jessie Salter, Carl Oliveros |
|---|---|
| Copyright: | This documentation is available under a Creative Commons (CC-BY) license. |
Modification History¶
Previous Versions¶
| Version | Description |
|---|---|
| 1.5 | Added on-bead PCR changes for post-enrichment amplification |
| 1.4 | Update Nextera blockers to give full-length blocking sequence with Inosines as universal blocker. Recommend final AMPure cleanup at 1.0X versus 1.8X. This produces larger (on average) contigs following assembly (March 28, 2013) |
| 1.3 | Change probe concentration to 2X of what we originally used. Update block mix with statement on using custom Cot-1 (e.g. chicken when working with birds). Title blocker section for TruSeq adapters. Add an Illumina Nextera blocker section (Sep. 11, 2012) |
| 1.2 | Cleanup to standardize and clarify (Mar. 6, 2012) |
| 1.1 | Change blocking adapters => 2 pairs of TruSeq primers versus 4. The new blockers incorporate inosine to bind to a 10 nt index sequence (Nov. 19, 2011) |
| 1.0 | Original |
Purpose¶
The purpose of this protocol is to adapt the SureSelect/MYcroarray/Arbor Biosciences enrichment kits for enrichments of UCE DNA libraries prepared using TruSeq/TruSeq-style/Illumina Nextera adapters and common library preparation kits. We also provide the reagent mixtures used in these kits (from Gnirke et al. 2009 and Blumenstiel et al. 2010), so that you can make more if necessary.
In essence, the protocol provided below is a hybrid of the original UCE enrichment protocol and the protocol provided with version 3 of the MYcroarray / Arbor Biosciences enrichment manual. Basically, the protocol below is a less stringent version of the MYcroarray protocol. We have also fleshed out the protocol description with some helpful hits that we’ve discovered after performing a number of enrichments.
Equipment¶
- Centrifuge
- Magnet stand or magnet plate
- Water bath or incubator
Materials¶
- DNA libraries at ~147 ng/uL
- SureSelect or MySelect or IDT bait library (stored at -80 C)
- SureSelect or MySelect hybridization reagents (Box 1 [-20 C] and Box 2 [Room Temperature]) or equivalent hybridization solutions (see below)
- 500 uM adapter blocking mix (IDT DNA) (AKA Block #3; see below)
- Strip tubes and caps or plates and rubber mats
- AMPure XP or Serapure substitute (home-brew AMPure)
- Life Technologies Dynabeads MyOne Streptavidin C1 (Life Technologies 65001)
If you need to prepare additional hybridization reagents:
- 20 X SSPE (Life Technologies AM9767) (Hyb #1)
- 0.5 M EDTA (Life Technologies AM9261) (Hyb #2)
- 50 X Denhardt’s Solution (Life Technologies 750018) (Hyb #3)
- 10 % SDS (Life Technologies AM9822) (Hyb #4)
- Human Cot-1 DNA (Life Technologies 15279-101) (Block #1) or Hyblock Cot-1 DNA (Applied Genetics Laboratories)
- Salmon sperm (Life Technologies 15632-011) (Block #2)
- Superase-IN (Life Technologies AM2694) (RNAse Blocker)
- 20 X SSC (Life Technologies AM9770) (for preparing wash buffer)
- 5 M NaCl (Amresco E529-500) (for preparing binding buffer)
Preparation¶
Pooling Libraries Before Enrichment¶
Depending on your intended targets/purpose, you may wish to pool several libraries together before enriching the pool of libraries. This usually makes the process much easier and faster, and we have used this approach extensively when enriching UCE libraries for various organismal groups. We generally pool 8 libraries together at equimolar ratios prior to beginning the enrichment process.
Adapter Blocking Mix¶
The blocking mix is one of the most critical components during the enrichment. Without it, you run the risk of adapter-ligated DNA hybridizing together end-to-end (“daisy-chaining”). You pull out what you want, but lots of other stuff you don’t want comes along in a big daisy chain. Thus, the purpose of Adapter Blocking Mix is to hybridize to the ends of adapter ligated DNA before you add your probe mix. As such, the blocking mix should match the adapters you’ve added to your libraries. Over time, we have used several different types of blocking mix, each of which are provided below.
Attention
If you are not sure which blocking oligos to use, you need to determine how your libraries were prepared. Currently, most libraries are dual indexed for illumina, in which case the 8 nucleotide iTru / TruSeq (double indexed) blockers will work well.
10 nucleotide TruSeq (single indexed) library blocker¶
If you are working with standard Illumina barcodes, you kit may contain the correct blockers for the sequencing adapters. If you are using longer indexes (e.g. 10 nt), you will need custom blockers. The blockers below assume 10 nt indexes. Adjust the number of Inosines (I) to reflect your index length.
- You need the following oligos (250 nM synthesis):
5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT - 3’
5’- CAAGCAGAAGACGGCATACGAGATIIIIIIIIIIGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - 3’
- Hydrate the above with ddH2O or TLE to 1000 uM (1 times the number of nMol)
- Combine 50 uL of each blocker in a 1.5 mL tube
- This is now equivalent to Block #3 and contains 500 µM each blocker
8 nucleotide Nextera library blocker¶
If you are enriching libraries prepared using either of Illumina’s Nextera Kits (Illumina Nextera or Illumina Nextera XT), then you need to block indexes on both ends of the library fragments. Nextera indexes are 8 bp long, each. The blockers below assume 8 nt indexes (the standard Nextera index length).
- You need the following oligos (250 nM synthesis):
5’ – AATGATACGGCGACCACCGAGATCTACACIIIIIIIITCGTCGGCAGCGTCAGATGTGTATAAGAGACAG - 3’
5’ – CAAGCAGAAGACGGCATACGAGATIIIIIIIIGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG - 3’
- Hydrate the above with ddH2O or TLE to 1000 uM (1 times the number of nMol)
- Combine 50 uL of each blocker in a 1.5 mL tube
- This is now equivalent to Block #3 and contains 500 µM each blocker
8 nucleotide iTru / TruSeq (double indexed) library blocker¶
If you are enriching libraries prepared using the iTru indexing system or Illumina’s double-indexed TruSeq protocol, you can use the following blocking oligos, which are outward facing and should ensure you do not accidentally produce PCR product from them.
- You need the following oligos (250 nM synthesis):
5’ – AGATCGGAAGAGCACACGTCTGAACTCCAGTCACIIIIIIIIATCTCGTATGCCGTCTTCTGCTTG - 3’
5’ – GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTIIIIIIIIGTGTAGATCTCGGTGGTCGCCGTATCAT - 3’
- Hydrate the above with ddH2O or TLE to 1000 uM (1 times the number of nMol)
- Combine 50 uL of each blocker in a 1.5 mL tube
- This is now equivalent to Block #3 and contains 500 µM each blocker
Bait Mixes¶
When ordering a “custom” enrichment kit, the number of baits synthesized may be greater than the number of baits designed for the targets. In this case, you can dilute the resulting kit to enrich more samples than the standard amount in a given kit. Some examples are given below. However, your mileage may vary, and diluting baits in a custom kit that you are testing for the first time may have negative effects. It is always best to titrate the baits to attempt to reach some sort of optimal solution.
Warning
If you are using a “catalog” kit from MYcroarray / Arbor Biosciences, then you generally do not want to dilute the bait set that you have ordered. These “catalog” kits are already diluted, so they can be sold at a lower price.
Agilent SureSelect¶
Depending on how you ordered your probes, they can vary in concentration. For birds, we have ordered the 2,200 probe set printed 25 times per “array” to fill out the array (55,000 spots / 2,200 probes). This means that every 1X aliquot of SureSelect probe mix contains 25X the probes that we actually want. When we target UCEs, we’ve discovered it’s best to use 2X probe mix with each sample or pool of samples. This is an increase from what we were originally using and is colloquially known as “2X” probe mix.
To enrich 1 sample¶
- Remove 0.5 uL of MySelect probe mix
- Add this to 4.5 uL of RNase free ddH2O
To enrich 12 samples¶
- Remove 6.0 uL of MySelect probe mix
- Add this to 54.0 uL of RNase free ddH2O
Mycroarray / Arbor Biosciences MYSelect¶
Similarly, if you’ve printed ~5,000 probes to fill out a 55,000 probe array, then each probe is represented approximately 10 times, so you have a 10X solution of probe mix. For a single sample, you’ll then want to dilute each aliquot of probes by a factor of 5.
To enrich 1 sample¶
- Remove 1.0 uL of MySelect probe mix
- Add this to 4.0 uL of RNase free ddH2O
To enrich 12 samples¶
- Remove 12.0 uL of MySelect probe mix
- Add this to 48.0 uL of RNase free ddH2O
Buffers¶
Binding buffer¶
- Assemble the following components in a 50 mL sterile conical tube (note units):
| Reagent | Amount |
|---|---|
| 5.0 M NaCl | 10 mL |
| 1.0 M Tris-HCl (pH 7.5) | 500 µL |
| 0.5 M EDTA | 100 µL |
| ddH2O | 39.4 mL |
| Total Volume | 50.0 mL |
- Rotate several times to mix.
Wash Buffer #1¶
- Assemble the following components in a 50 mL sterile conical tube (note units):
| Reagent | Amount |
|---|---|
| 20X SSC | 2.5 mL |
| 10% SDS | 0.5 mL |
| ddH2O | 47 mL |
| Total Volume | 50 mL |
- Rotate several times to mix.
Wash Buffer #2¶
- Assemble the following components in a 50 mL sterile conical tube (note units):
| Reagent | Amount |
|---|---|
| 20X SSC | 250 µL |
| 10% SDS | 500 µL |
| ddH2O | 49.25 mL |
| Total Volume | 50 mL |
- Rotate several times to mix.