Running RADcap Analysis¶
| Author: | Jessie Salter and Brant C. Faircloth |
|---|---|
| Copyright: | This documentation is available under a Creative Commons (CC-BY) license. |
Modification History¶
Purpose¶
The following assumes you are demultiplexing RADcap data prepared with enzymes and the i5-8N tag. Otherwise, if you used standard libraries for RADcap locus enrichment, you can demultiplex those data like usual.
Preliminary Steps¶
To compile stacks when using LSU HPC, be sure to
module load gcc/6.4.0or enable this modules in your~/.modulesfileGet Stacks, configure (w/ home directory install), and install. The commands below need to be modified for your setup because they are set to install everything into
/project/brant/home/, which you don’t have access to.wget https://catchenlab.life.illinois.edu/stacks/source/stacks-2.54.tar.gz tar -cxzvf stacks-2.54.tar.gz cd stacks-2.54 export CC=`which gcc` export CXX=`which g++` ./configure --prefix=/project/brant/home/ make # if using an entire node, you can `make -j 20` make install
Get BBmap, and install that somewhere. Basically download and place the files somewhere in your
$PATHmkdir $HOME/bin wget https://downloads.sourceforge.net/project/bbmap/BBMap_38.87.tar.gz tar -xzvf BBMap_38.87.tar.gz # this will create a folder bbmap which you need to add to your $PATH
Note
If you are in my lab group, these are installed in $HOME/project/brant/bin
Steps¶
- Upload the relevant data to some location on @smic. These should not have been demultiplexed in any way.
- You may want to check to ensure the MD5 checksums of your files uploaded match the MD5 checksums that you expect. Usually, you receive these from the sequencing center.
- If you have multiple files (for some reason), you can combine the files together for READ1 and then combine the files together for READ2.
Your Data Contain Randomly Sheared DNA (“standard” libraries)¶
If your data contain RADcap performed on randomly sheared or “standard” sequencing libraries that are mixed with “regular” RAD-cap libraries, we’ll go ahead and demultiplex the randomly sheared, RADcap data, first. Once that’s done, we will demultiplex the remaining reads containing i5-8N tags.
I am starting with a directory structure that looks like this:
. ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_1.fq.gz └── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_2.fq.gz
The procedure for these standard libraries is identical to the one described in Demultiplexing a Sequencing Run, so refer to that document, demultiplex, rename your files, and return here.
When I’m done with this first step, my directory structure looks something like this, although you may have renamed the individual read files following the instructions in Demultiplexing a Sequencing Run:
. ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_1.fq.gz ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_2.fq.gz └── random-libraries ├── ACCATCCA+ACATTGCG_R1_001.fastq.gz ├── ACCATCCA+ACATTGCG_R2_001.fastq.gz ├── ... ├── demuxbyname.e631878 ├── demuxbyname.o631878 ├── demux.qsub ├── my_barcodes.txt ├── Undetermined_R1_001.fastq.gz └── Undetermined_R2_001.fastq.gzYou now want to jump to Running GATK in Parallel, and follow the procedure for trimming reads, generating a BAM file, removing duplicates, haplotype calling, etc. If you have data containing i7+i5-8N tags, you will merge the samples back together after haplotype calling.
Your Data Contain i7 + i5-8N Tags¶
We next need to demultiplex the data that are
i7 + i5-8Nby the i7 tag, then we will process those “plates” worth of data, separately to find restriction sites, deal with the i5-8N tags, etc. We can do this several ways and one of those ways uses Stacks, however Stacks is relatively slow for this task when faster options exist. So, we will (as above) use demuxbyname.sh from BBMap.Before we demultiplex, we need to create a file of indexes. This will be similar to, but slightly different from how these data were demultiplexed, above. So, create a file, e.g., my_i7_indexes.txt that contains all of the i7 indexes you have paired with i5-8N indexes. The file MUST have each entry appended with a + because we are using substring matching to ensure we get what we want, and this makes the most appropriate substring. So, if I have 4 i7 indexes, I want to create a directory containing a file that looks like the following, where the sequences to the left of the + represent the i7 indexes. So,
mkdir i5-8N_libraries, then create a file my_i7_indexes.txt in that directory containing:CGAACTGT+ CATTCGGT+ TCGGTTAC+ AGTCGCTT+
My directory structure now looks like:
. ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_1.fq.gz ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_2.fq.gz ├── i5-8N_libraries │ └── my_i7_indexes.txt └── random-libraries ├── ACCATCCA+ACATTGCG_R1_001.fastq.gz ├── ACCATCCA+ACATTGCG_R2_001.fastq.gz ├── ... ├── demuxbyname.e631878 ├── demuxbyname.o631878 ├── demux.qsub ├── my_barcodes.txt ├── Undetermined_R1_001.fastq.gz └── Undetermined_R2_001.fastq.gzWe’re almost ready to demultiplex, but before we do and if you already demultiplexed “standard” libraries, make sure the files you are demultiplexing this time are the ``Undetermined_*`` files left over from the initial round of demultiplexing (e.g. Undetermined_R1_001.fastq.gz in the directory structure, above). Once you are sure that is so, you can setup demultiplexing. I usually do this in a folder one level below the read data I am demultiplexing (
i5-8N_libraries):#!/bin/bash #PBS -A <allocation> #PBS -l nodes=1:ppn=20 #PBS -l walltime=12:00:00 #PBS -q workq #PBS -N demuxbyname module load jdk/1.8.0_161 # move into the directory containing this script cd $PBS_O_WORKDIR $HOME/project/shared/bin/bbmap/demuxbyname.sh \ prefixmode=f \ substring=t \ in=../random-libraries/Undetermined_R1_001.fastq.gz \ in2=../random-libraries/Undetermined_R2_001.fastq.gz \ out=%_R1_001.fastq.gz \ out2=%_R2_001.fastq.gz \ outu=Undetermined_R1_001.fastq.gz \ outu2=Undetermined_R2_001.fastq.gz \ names=my_i7_indexes.txt
Once that finishes, the directory structure looks something like this (
random-librariesis collapsed):. ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_1.fq.gz ├── AEM1_CKDL200166465-1a_HF5GHCCX2_L3_2.fq.gz ├── i5-8N_libraries │ ├── AGTCGCTT+_R1_001.fastq.gz │ ├── AGTCGCTT+_R2_001.fastq.gz │ ├── CATTCGGT+_R1_001.fastq.gz │ ├── CATTCGGT+_R2_001.fastq.gz │ ├── CGAACTGT+_R1_001.fastq.gz │ ├── CGAACTGT+_R2_001.fastq.gz │ ├── demuxbyname.e631893 │ ├── demuxbyname.o631893 │ ├── demux.qsub │ ├── my_i7_indexes.txt │ ├── TCGGTTAC+_R1_001.fastq.gz │ ├── TCGGTTAC+_R2_001.fastq.gz │ ├── Undetermined_R1_001.fastq.gz │ └── Undetermined_R2_001.fastq.gz └── random-libraries
Now, within the
i5-8N_librariesdirectory, we need to demultiplex the samples within each “plate” (or for each set of unique i7 indexes). There are several ways that you can set this up (serially or parallel), but let’s assume that you just want to do this serially for each “plate”, because there are only a handful of plates. I would start by making a directory for each plate (e.g.mkdir CGAACTGT+or rename as needed). Once that’s done, you need to navigate into that directory and create a file of the internal index sequences and the sample names associated with those sequences (e.g.CGAACTGT_internal_indexes.txt) . You also need to add some nucleotides to each index, and this can get a little messy, so the easiest way to do this is to download this file, fill in the required information, and copy the contents noted into theCGAACTGT_internal_indexes.txtfile. The file contents will look something like:CCGAATG CTAACGT Sample_22 CCGAATG TCGGTACT Sample_23 CCGAATG GATCGTTGT Sample_24 CCGAATG AGCTACACTT Sample_25 CCGAATG ACGCATT Sample_26 CCGAATG GTATGCAT Sample_27 CCGAATG CACATGTCT Sample_28 CCGAATG TGTGCACGAT Sample_29 TTAGGCAG CTAACGT Sample_30 TTAGGCAG TCGGTACT Sample_31 TTAGGCAG GATCGTTGT Sample_32 TTAGGCAG AGCTACACTT Sample_33 TTAGGCAG ACGCATT Sample_34 TTAGGCAG GTATGCAT Sample_35 TTAGGCAG CACATGTCT Sample_36 TTAGGCAG TGTGCACGAT Sample_37 AACTCGTCG CTAACGT Sample_38 AACTCGTCG TCGGTACT Sample_39 AACTCGTCG GATCGTTGT Sample_40 AACTCGTCG AGCTACACTT Sample_41 AACTCGTCG ACGCATT Sample_42 AACTCGTCG GTATGCAT Sample_43 AACTCGTCG CACATGTCT Sample_44 AACTCGTCG TGTGCACGAT Sample_45 GGTCTACGTG CTAACGT Sample_46 GGTCTACGTG TCGGTACT Sample_47 GGTCTACGTG GATCGTTGT Sample_48 GGTCTACGTG AGCTACACTT Sample_49 GGTCTACGTG ACGCATT Sample_50 GGTCTACGTG GTATGCAT Sample_51 GGTCTACGTG CACATGTCT Sample_52 GGTCTACGTG TGTGCACGAT Sample_53 GATACCG CTAACGT Sample_54 GATACCG TCGGTACT Sample_55 GATACCG GATCGTTGT Sample_56 GATACCG AGCTACACTT Sample_57 GATACCG ACGCATT Sample_58 GATACCG GTATGCAT Sample_59 GATACCG CACATGTCT Sample_60 GATACCG TGTGCACGAT Sample_61 TCATGGTCAG CTAACGT Sample_62 TCATGGTCAG TCGGTACT Sample_63 TCATGGTCAG GATCGTTGT Sample_64 TCATGGTCAG AGCTACACTT Sample_65 TCATGGTCAG ACGCATT Sample_66 TCATGGTCAG GTATGCAT Sample_67 TCATGGTCAG CACATGTCT Sample_68 TCATGGTCAG TGTGCACGAT Sample_69
The directory structure now looks something like this:
. ├── AGTCGCTT+_R1_001.fastq.gz ├── AGTCGCTT+_R2_001.fastq.gz ├── CATTCGGT+_R1_001.fastq.gz ├── CATTCGGT+_R2_001.fastq.gz ├── CGAACTGT+ │ └── CGAACTGT_internal_indexes.txt ├── CGAACTGT+_R1_001.fastq.gz ├── CGAACTGT+_R2_001.fastq.gz ├── demuxbyname.e631893 ├── demuxbyname.o631893 ├── demux.qsub ├── my_i7_indexes.txt ├── TCGGTTAC+_R1_001.fastq.gz ├── TCGGTTAC+_R2_001.fastq.gz ├── Undetermined_R1_001.fastq.gz └── Undetermined_R2_001.fastq.gz
Once that’s done, we can start the demultiplexing by creating a qsub script (
internal_dmux.qsub) that looks like this:#!/bin/bash #PBS -A <allocation> #PBS -l nodes=1:ppn=1 #PBS -l walltime=12:00:00 #PBS -q single #PBS -N radcap_demux_p1 # move into the directory containing this script cd $PBS_O_WORKDIR process_radtags \ -1 ../CGAACTGT+_R1_001.fastq.gz \ -2 ../CGAACTGT+_R2_001.fastq.gz \ -i gzfastq \ -b CGAACTGT_internal_indexes.txt \ --inline_inline \ -o ./ \ -c -q -r -t 140 -w 0.15 -s 10 \ --renz_1 nheI \ --renz_2 ecoRI \ --adapter_mm 2 \ --adapter_1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \ --adapter_2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ --retain-header
And, the directory structure looks like this:
. ├── AGTCGCTT+_R1_001.fastq.gz ├── AGTCGCTT+_R2_001.fastq.gz ├── CATTCGGT+_R1_001.fastq.gz ├── CATTCGGT+_R2_001.fastq.gz ├── CGAACTGT+ │ ├── CGAACTGT_internal_indexes.txt │ └── internal_dmux.qsub ├── CGAACTGT+_R1_001.fastq.gz ├── CGAACTGT+_R2_001.fastq.gz ├── demuxbyname.e631893 ├── demuxbyname.o631893 ├── demux.qsub ├── my_i7_indexes.txt ├── TCGGTTAC+_R1_001.fastq.gz ├── TCGGTTAC+_R2_001.fastq.gz ├── Undetermined_R1_001.fastq.gz └── Undetermined_R2_001.fastq.gz
Now, submit the job and let it run. Proceed to do the same across the other plates of samples, adjusting the contents of the
*_internal_indexes.txtfile for whatever samples are in that plate.Note
It takes a while for Stacks to write data to the files that are visible in the output directory you choose. So, just be sure to give it some time to run (~10 minutes) before worrying too much about something wrong with how you set it up. The results also come somewhat slowly across all samples.
Also be aware that the steps above usually take 3-6 hours to run. If you have multiple plates of data, it would be sensible to setup jobs to demultiplex those, as well.
Once the data are demultiplexed, we need to remove duplicate reads. Because we need to do this across many files (for all samples in each “plate”), we’ll use GNU Parallel. To get that process started, first make a new directory within each demultiplexed plate named
process_radtags-removedand move all*.rem.1.fq.gzfiles there (alternatively, you can delete them).mkdir process_radtags-remove mv *.rem.*.fq.gz process_radtags-removed
You probably also want to check to see if any of the read files in the directory are very small (kB instead of MB). You can do that with the following, which finds files < 2 MB in size. I would probably remove these samples from further consideration:
find . -maxdepth 1 -type f -size -2MNext, make a new directory,
duplicates-removedin the folder where you are working. The directory structure will look like this:. ├── AGTCGCTT+_R1_001.fastq.gz ├── AGTCGCTT+_R2_001.fastq.gz ├── CATTCGGT+_R1_001.fastq.gz ├── CATTCGGT+_R2_001.fastq.gz ├── CGAACTGT+ │ ├── CGAACTGT_internal_indexes.txt │ ├── duplicates-removed │ ├── internal_dmux.qsub │ ├── process_radtags-remove │ ├── Sample_22.1.fq.gz │ ├── ... │ └── Sample_69.2.fq.gz ├── CGAACTGT+_R1_001.fastq.gz ├── CGAACTGT+_R2_001.fastq.gz ├── demuxbyname.e631893 ├── demuxbyname.o631893 ├── demux.qsub ├── my_i7_indexes.txt ├── TCGGTTAC+_R1_001.fastq.gz ├── TCGGTTAC+_R2_001.fastq.gz ├── Undetermined_R1_001.fastq.gz └── Undetermined_R2_001.fastq.gz
Change into this new folder and generate an input file that will contain
<sample_name>,<read1 path>,<read2 path>using the following:for i in ../*.1.fq.gz; do b=`basename $i`; sample=${b%%.*}; echo "$sample,../$sample.1.fq.gz,../$sample.2.fq.gz" >> sample.list; done
We need to create a script that we will run with parallel that contains the code to remove duplicates. Create a new file,
clone_filter.shand add to it the following:#!/bin/bash READ1=$2 READ2=$3 # echo name of sample to stdout echo $SAMPL # make a directory for output mkdir -p $SAMPL # remove PCR duplicates clone_filter \ -P \ -i gzfastq \ --null-index \ --oligo-len-2 8 \ -1 $READ1 \ -2 $READ2 \ -D
Once that’s done, you need to make it executable, so
chmod +x clone_filter.sh.Now, create your qsub script,
remove_duplicates.qsubin the same directory. You will want to set the number of nodes to something reasonable - e.g. like ~2 for 100 samples. The code uses 1 core per sample, so that would allocate 40 cores to the job. With 150-200 MB data per sample, each sample runs in about 3 minutes.#!/bin/bash #PBS -A <allocation> #PBS -l nodes=1:ppn=1 #PBS -l walltime=12:00:00 #PBS -q single #PBS -N radcap_clonefilter_p1 # load the GNU parallel module (on @smic) module load parallel/20190222/intel-19.0.5 # move into the directory containing this script cd $PBS_O_WORKDIR # Number of Cores per job export CORES_PER_JOB=1 # move into the directory containing this script cd $PBS_O_WORKDIR # set the number of Jobs per node based on $CORES_PER_JOB export JOBS_PER_NODE=$(($PBS_NUM_PPN / $CORES_PER_JOB)) parallel --colsep '\,' \ --progress \ --joblog logfile.$PBS_JOBID \ -j $JOBS_PER_NODE \ --slf $PBS_NODEFILE \ --workdir $PBS_O_WORKDIR \ -a sample.list \ ./clone_filter.sh {$1} {$2} {$3}
Submit the job with qsub.
That will take a little while to finish. When it’s done, output regarding the percentage duplication will be in the
stderrfile. You can access the parts that are important with something like:cat radcap_declone_p1.e* | grep "^Processing\|clone reads
This will output data that look like the following, so that you can extract the important information (% clone/duplicated reads):
Processing file 1 of 1 [Sample_24.1.fq.gz] 1524053 pairs of reads input. 1186384 pairs of reads output, discarded 337669 pairs of reads, 22.16% clone reads. Processing file 1 of 1 [Sample_23.1.fq.gz] 1603923 pairs of reads input. 1271849 pairs of reads output, discarded 332074 pairs of reads, 20.70% clone reads. Processing file 1 of 1 [Sample_22.1.fq.gz] 2159065 pairs of reads input. 1659710 pairs of reads output, discarded 499355 pairs of reads, 23.13% clone reads. Processing file 1 of 1 [Sample_26.1.fq.gz] 2608250 pairs of reads input. 2033327 pairs of reads output, discarded 574923 pairs of reads, 22.04% clone reads. Processing file 1 of 1 [Sample_25.1.fq.gz] 2867423 pairs of reads input. 2185931 pairs of reads output, discarded 681492 pairs of reads, 23.77% clone reads.
The last thing we need to do is to navigate into the
duplicates-removeddirectory, create a new directorydiscardsand move all of the discarded (duplicate) reads into that directory:mkdir discards mv *.discards.*.fq.gz discards
You can either retain or delete this
discardsfolder. I usually keep it around to check and make sure the results are sensible. Then I delete.Now that this is finished, we’re ready to move forward with aligning the RADcap data to our genome sequence. You need to think about how you want to do this, because there several paths forward. You can basically jump into analyzing your data with Stacks by jumping to Reference-based Analysis and following the process for generating BAM files. Alternatively, because you’ve marked duplicates, you can analyze your data with GATK by jumping to Read Alignment and following the process for generating BAM files. You will NOT run Duplicate Remove. Remember that if you also have randomly sheared libraries enriched with RADcap, you’ll need to integrate them BAM files from those data to the BAM files from your i5-8N RADcap libraries. This happens after generating BAM files (for the Stacks approach) and after Haplotype Calling (for the GATK approach).
Final Steps¶
- Once you have generated VCF files for the SNPs you have called, it is a very good idea to filter those VCF files to include only the loci/sites that you enriched with RADcap. You will do this using VCFTools and a BED-formatted file of your RADcap loci and the position of those loci in the genome with which you are working.